Atheist Student: There’s not enough evidence to believe in God.
Christian Speaker: What evidence would convince you?
Atheist Student: If God suddenly wrote in the sky “Hey Roger, this is God. I’m here now stop whining and believe.”
Christian Speaker: I would agree that would be convincing, and here’s why…
“Hey Roger, this is God. I’m here now stop whining and believe.” It’s a simple message, only 12 words long. Nothing completely unknown or beyond our human understanding. So why would that be enough to convince someone in the existence of God?
Information rich messages are only created by intelligent minds.
If you see “Dan loves Susie” (yes Susie is my wife) written in the sand, do you assume a crab wrote it? Do you think the waves just put the message there? No, you assume a person wrote, and we all know that you would be correct. What if you found a stone with strange symbols on it? The symbols repeated themselves from time to time, but you had no idea what they meant. Would you think, for even an instant, that water eroded the symbols into the stone? Would you wonder if the sedimentary rock just happened to form the symbols? No, you assume a person or people carved the symbols into the rock, and we all know you would be correct. We don’t even have to know how to interpret the symbols to recognize the intelligence.
Does the medium the information is transmitted on make a difference?
- Paper
- Rock
- Papyrus
- Computer chip
- Audio waves
- Sand
- Smoke signals
We may make some inference about the time it was transmitted, or the scientific knowledge of the people who transmitted the message, but does the medium the information is on make any difference in our deciding if it was created by an intelligent mind? Of course not.
What about the language or the code it is written in…does that matter?
- To be or not to be, that is the question.
- Ser o no ser, esa es la cuestión.
- أن تكون أو لا تكون، هذا هو السؤال.
- Pour être ou ne pas être, telle est la question.
- Για να είναι ή να μην είναι, αυτό είναι το ερώτημα.
- 54 6f 20 62 65 20 6f 72 20 6e 6f 74 20 74 6f 20 62 65 2c 20 74 68 61 74 20 69 73 20 74 68 65 20 71 75 65 73 74 69 6f 6e 2e
- – — / -… . / — .-. / -. — – / – — / -… . –..– / – …. .- – / .. … / – …. . / –.- ..- . … – .. — -. .-.-.-
- TAGTGTAGCCATCTAAGCTGTCACAGCCTCTGTTAGAGCTAGTGTAGCCATCTAAGCTAGCGTACTTAGAGCCTGTGAAGCTAGCGTCTAAGCTATGATCTATGATAGCTGTGTCTC
Let’s think about the last book you read, or even magazine article (or blog post). Does it matter if your copy was hardcover or paperback or Kindle or Audiobook? No, let’s face it, the language or the code doesn’t really matter, we assume information comes from intelligence.
And did you ever once consider that the information had no author? Not that we didn’t know the author, but that there was no author? No, admit it, the possibility of a book or article having no author is ridiculous. Do you think for one minute you could blow up a printing factory and end up with a new literary work? How about if we left a high pressure paint sprayer with a fine spray run wildly inside a room with white walls? Do you have any hope the walls would have a best seller written on them…or even a worst seller? Be honest.
So what about DNA?
Is it a code or language? It uses the markers CAGT and puts them into very complex groupings. Just as in most of our languages we put letters and spaces together to make words, and words to make sentences, and sentences…..so DNA groups these markers together in multiple levels. Our own computers use just X and O (or 1 and 0). By using 4 markers DNA is, at is core, exponentially more complex than our most complex computer data storage system. Most would argue that it is the most complex information storage code ever developed.
So just how good is DNA at storing information?
- The DNA in just 1 cell holds more information than 1,000 average encyclopedia Britannica books.
- All the books in the Library of Congress could be stored in a mass of DNA approximately the size of 1% of the head of a pin.
- There are several companies racing to create a computer drive that uses DNA as the data storage media. Should they succeed they would be able to fit all the information on all the hard drives that exist in the entire world on a mass of DNA about half the size of a deck of cards.
Would you, and any honest intelligent person, not agree that DNA is the most dense source or information known to exist?
Is DNA really information? Seriously? Biologist have long heralded DNA as the information of life itself. Cells, plants, animals and humans all require it to form and grow. It instructs our body regarding what organs and tissues to produce where and how. When the DNA is “messed up” we get mutations and cancers. Within the structure itself is not only information, but a method to retrieve the right information at the right time. Some, though not I, believe that our DNA determines our very thoughts.
Can you think of any information known to exist that is more valuable than the code of life itself?
So what exactly are you truly willing to believe?
- That a stone covered in ancient symbols was created by water erosion?..No.
- That a book can come from the explosion of a printing press with no author?…No
- That the most complex, dense, and valuable information known to exist was created from a primordial soup that came from nothing and that information has no author and represents no intelligence?…Seriously?
You don’t have to be a Nobel Prize winning biologist to answer this question correctly. If you are willing to have an open mind, think logically and follow the truth wherever it leads, this is a no brainer. So why do so many intelligent people refuse to come to this obvious conclusion? Read on, but think about O.J. Simpson.
